Sequence ID | >W1610772164 |
Genome ID | LNST01000020 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Xanthomonas translucens [LNST] |
Start position on genome | 10932 |
End posion on genome | 11008 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
tccggcccgg |
tRNA gene sequence |
GCGCCCGTAGCTCAACCGGATAGAGCACCGGCCTTCTAAGCCGGCGGTTACAGGTTCGAT |
Downstream region at tRNA end position |
caccggtgcc |
Secondary structure (Cloverleaf model) | >W1610772164 Arg TCT g GCCA caccggtgcc G - C C - G G - C C - G C - G C - G G - C T T T T G T C C A C A A A | | | | | G C C T C G A C A G G C G | | | | T T G G A G C A T A A CGGTT C - G C - G G - C G - C C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |