| Sequence ID | >W1610772519 |
| Genome ID | LNTB01000001 |
| Phylum/Class | Thermoproteota |
| Species | Pyrodictium occultum PL-19 [LNTB] |
| Start position on genome | 120604 |
| End posion on genome | 120526 |
| Amino Acid | Gly |
| Anticodon | TCC |
| Upstream region at tRNA start position |
ggcatggagc |
| tRNA gene sequence |
GCGGCGGTCGTCTAGCCTGGACTAGGACGCCGGCCTTCCAAGCCGGCGATCCCGGGTTCA |
| Downstream region at tRNA end position |
accctcaaag |
| Secondary structure (Cloverleaf model) | >W1610772519 Gly TCC
c ACCA accctcaaag
G - C
C - G
G - C
G - C
C - G
G - C
G - C T A
T G G C C C A
C C G A C | | | | | A
T T C T G C C G G G C
G + | | | T T
G G G A C
A C T A G CGATC
C - G
C - G
G - C
G - C
C - G
C A
T A
T C C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |