Sequence ID | >W1610775735 |
Genome ID | LNWI01000037 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Tritonibacter mobilis [LNWI] |
Start position on genome | 72669 |
End posion on genome | 72743 |
Amino Acid | Val |
Anticodon | CAC |
Upstream region at tRNA start position |
ccggcctcac |
tRNA gene sequence |
GGGTGATTAGCTCAGTGGTAGAGCGCTTCGTTCACATCGAAGATGTCAGGAGTTCAAATC |
Downstream region at tRNA end position |
ttctacccct |
Secondary structure (Cloverleaf model) | >W1610775735 Val CAC c ACCA ttctacccct G - C G - C G - C T - A G - C A - T T - A T A T T T C T C A G A A | + | | | A T C T C G A G G A G C G | | | | T T G G A G C T A G ATGTC C - G T - A T - A C - G G - C T T T A C A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |