Sequence ID | >W1610776006 |
Genome ID | LNWO01000013 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Tritonibacter mobilis [LNWO] |
Start position on genome | 57528 |
End posion on genome | 57617 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
ctgcagaacc |
tRNA gene sequence |
GGGGAGGTGGCAGAGTGGTCGAATGCGGCGGTCTTGAAAACCGTTGAACGTGAGAGCGTT |
Downstream region at tRNA end position |
ttaaatcaat |
Secondary structure (Cloverleaf model) | >W1610776006 Ser TGA c GCCA ttaaatcaat G - C G - C G - C G - C A - T G - C G + T T A T G T C C C A T G A G | | | | | G G G A C G C A G G G C G | | | T T T A T G C C G A G TGAACGTGAGAGCGTTCC G + T C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |