Sequence ID | >W1610777833 |
Genome ID | LNYB01000085 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Legionella feeleii [LNYB] |
Start position on genome | 346540 |
End posion on genome | 346465 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
gcaaaaaaaa |
tRNA gene sequence |
GGGGTCGTAGCTCAGCTGGGAGAGCACCTGCCTTGCACGCAGGGGGTCGGGAGTTCGATC |
Downstream region at tRNA end position |
aacactcgtt |
Secondary structure (Cloverleaf model) | >W1610777833 Ala TGC a ACCA aacactcgtt G - C G - C G + T G - C T + G C - G G - C C T T C C C T C A C G A A | | | | | G T C T C G G G G A G C G | | | | T T G G A G C G A A GGGTC C - G C - G T - A G - C C - G C C T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |