Sequence ID | >W1610784309 |
Genome ID | LOEP01000029 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Haloferax sp. Q22 [LOEP] |
Start position on genome | 73007 |
End posion on genome | 73089 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
gcccgattgc |
tRNA gene sequence |
GCGCGGGTAGCCAAGTGGCCAAAGGCGCAGCGCTTAGGACGCTGTGGTGTAGACCTTCGC |
Downstream region at tRNA end position |
cgtctcgaac |
Secondary structure (Cloverleaf model) | >W1610784309 Leu TAG c Atac cgtctcgaac G - C C - G G - C C - G G - C G - C G - C C A T T G T C C A T G A A + | | | | G G A C C G G C A G G C G | | | T T C A G G C C A A G TGGTGTAGACCTTC C - G A - T G - C C - G G - C C A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |