Sequence ID | >W1610784491 |
Genome ID | LOEV01000021 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Alphaproteobacteria bacterium BRH_c36 [LOEV] |
Start position on genome | 11842 |
End posion on genome | 11767 |
Amino Acid | Lys |
Anticodon | CTT |
Upstream region at tRNA start position |
tcacatcatc |
tRNA gene sequence |
GGGTGATTAGCTCAGTTGGTAGAGCAGCTGACTCTTAATCAGCGGGTCGAAGGTTCGAAT |
Downstream region at tRNA end position |
attttcatga |
Secondary structure (Cloverleaf model) | >W1610784491 Lys CTT c ACCA attttcatga G - C G - C G - C T - A G - C A - T T - A T A T C T T C C A T G A A | | | | | G T C T C G G A A G G C G | | | | T T G G A G C T A A GGGTC G - C C - G T - A G - C A - T C A T A C T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |