Sequence ID | >W1610784674 |
Genome ID | LOFG01000012 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Pseudoalteromonas sp. H103 [LOFG] |
Start position on genome | 422371 |
End posion on genome | 422297 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
agctcgatgt |
tRNA gene sequence |
GGCCTCTTAGTTAAATGGATATAACGGCCCCCTCCTAAGGGGCAGTTGTAGGTTCGATTC |
Downstream region at tRNA end position |
accaaaaaac |
Secondary structure (Cloverleaf model) | >W1610784674 Arg CCT t ACCA accaaaaaac G + T G - C C - G C - G T + G C - G T - A T T T C G T C C A T A A A | + | | | G G A T T G G T A G G C G | | | | T T A T A A C T A G AGTT G - C C - G C - G C - G C - G C A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |