Sequence ID | >W1610793452 |
Genome ID | LOMD01000087 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Legionella pneumophila [LOMD] |
Start position on genome | 8744 |
End posion on genome | 8818 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
gttgaattat |
tRNA gene sequence |
AGGCACGTAGCTCAGTGGTAGAGCACCACCTTGACATGGTGGTGGTCGGTGGTTCGATCC |
Downstream region at tRNA end position |
taattcctgg |
Secondary structure (Cloverleaf model) | >W1610793452 Val GAC t ACCA taattcctgg A - T G - C G - C C - G A - T C - G G - C C T T T C A C C A G A A + | | | | G T C T C G G G T G G C G | | | | T T G G A G C T A A TGGTC C - G C - G A - T C - G C - G T T T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |