| Sequence ID | >W1610803780 |
| Genome ID | LOSO01000015 |
| Phylum/Class | Actinomycetota |
| Species | Microbacterium sp. CH1 [LOSO] |
| Start position on genome | 148910 |
| End posion on genome | 148836 |
| Amino Acid | Asp |
| Anticodon | GTC |
| Upstream region at tRNA start position |
acaccagtat |
| tRNA gene sequence |
GGCCCTGTAGCGCAGTTGGTTAGCGTGCCGCCCTGTCACGGCGGAGGTCGCGGGTTCAAG |
| Downstream region at tRNA end position |
cgtgcgacga |
| Secondary structure (Cloverleaf model) | >W1610803780 Asp GTC
t GCtc cgtgcgacga
G - C
G + T
C - G
C - G
C - G
T - A
G - C T G
T T G C C C A
T G A A + | | | | A
T C G C G G C G G G C
G | | | + T T
G G C G T
T T A G AGGTC
C - G
C - G
G - C
C - G
C - G
C C
T A
G T C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |