Sequence ID | >W1610840144 |
Genome ID | LPRG01000006 |
Search identical group | |
Phylum/Class | Thermoproteota |
Species | Sulfolobus acidocaldarius GG12-C01-05 [LPRG] |
Start position on genome | 281064 |
End posion on genome | 280989 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
ggggtaaaaT |
tRNA gene sequence |
AGCGGCGTAGGGAAGCCTGGTATCCCGCAGGGCTCATAACCCTGAGGTCCCTGGTTCAAA |
Downstream region at tRNA end position |
cttccctaca |
Secondary structure (Cloverleaf model) | >W1610840144 Met CAT T AAtg cttccctaca A - T G - C C - G G - C G - C C - G G - C T A T G G A C C A C G A A | | | | | A C A G G G C C T G G C T | | | | T T G T C C C G T A G AGGTC C - G A - T G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |