Sequence ID | >W1610840201 |
Genome ID | LPRI01000003 |
Search identical group | |
Phylum/Class | Thermoproteota |
Species | Sulfolobus acidocaldarius GG12-C01-08 [LPRI] |
Start position on genome | 463647 |
End posion on genome | 463572 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
tgatataaaT |
tRNA gene sequence |
GGGCCCGTAGCTTAGCCTGGTAGAGCGTCCGGCTGATAACCGGAAGGCCGTGGGTTCAAA |
Downstream region at tRNA end position |
gagggtcctc |
Secondary structure (Cloverleaf model) | >W1610840201 Ile GAT T ATga gagggtcctc G - C G - C G - C C - G C - G C - G G - C T A T C A C C C A C G A A | | | | | A C T T C G G T G G G C T + | | | T T G G A G C G T A G AGGCC T - A C - G C - G G - C G - C C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |