| Sequence ID | >W1610840237 |
| Genome ID | LPRK01000001 |
| Phylum/Class | Thermoproteota |
| Species | Sulfolobus acidocaldarius GG12-C01-11 [LPRK] |
| Start position on genome | 58946 |
| End posion on genome | 58872 |
| Amino Acid | Thr |
| Anticodon | GGT |
| Upstream region at tRNA start position |
tttcatatat |
| tRNA gene sequence |
GCCGCGGTAGCTCAGCCTGGCTAGAGCGTTGCCCTGGTAAGGCAAAGGTCCCGGGTTCAA |
| Downstream region at tRNA end position |
ttttacaata |
| Secondary structure (Cloverleaf model) | >W1610840237 Thr GGT
t Ttac ttttacaata
G - C
C - G
C - G
G - C
C - G
G - C
G - C T A
T G G C C C A
C C G A A | | | | | A
T C T C G C C G G G C
G | | | | T T
G G A G C
C T A G AGGTC
T - A
T - A
G - C
C - G
C - G
C A
T A
G G T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |