| Sequence ID | >W1610840239 |
| Genome ID | LPRK01000002 |
| Phylum/Class | Thermoproteota |
| Species | Sulfolobus acidocaldarius GG12-C01-11 [LPRK] |
| Start position on genome | 81677 |
| End posion on genome | 81752 |
| Amino Acid | Arg |
| Anticodon | TCG |
| Upstream region at tRNA start position |
gttagtttat |
| tRNA gene sequence |
GGACCCGTAGCTCAGCCAGGACAGAGCGCTGGCCTTCGGAGCCAGTGGTCCCGGGTTCAA |
| Downstream region at tRNA end position |
tgggggtaca |
| Secondary structure (Cloverleaf model) | >W1610840239 Arg TCG
t GCtg tgggggtaca
G - C
G - C
A - T
C - G
C - G
C - G
G - C T A
T G G C C C A
C C G A A | | | | | A
A C T C G C C G G G C
G | | | | T T
G G A G C
A C A G TGGTC
C - G
T - A
G - C
G - C
C - G
C A
T G
T C G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |