| Sequence ID | >W1610840258 |
| Genome ID | LPRK01000002 |
| Phylum/Class | Thermoproteota |
| Species | Sulfolobus acidocaldarius GG12-C01-11 [LPRK] |
| Start position on genome | 1160534 |
| End posion on genome | 1160459 |
| Amino Acid | Pro |
| Anticodon | TGG |
| Upstream region at tRNA start position |
gttatagtga |
| tRNA gene sequence |
GGGGCCGTAGTCTAGCTTGGACTAGGATGCCAGGCTTGGGCCCTGGTGGTCCCGGGTTCA |
| Downstream region at tRNA end position |
taaaaaattt |
| Secondary structure (Cloverleaf model) | >W1610840258 Pro TGG
a Agac taaaaaattt
G - C
G - C
G - C
G - C
C - G
C - G
G - C T A
T G G C C C A
T C G A A | | | | | A
T T C T G C C G G G C
G + | | + T T
G G G A T
A C T A G TGGTC
C - G
C - G
A - T
G - C
G - C
C C
T G
T G G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |