| Sequence ID | >W1610840348 |
| Genome ID | LPRO01000001 |
| Phylum/Class | Thermoproteota |
| Species | Sulfolobus acidocaldarius GG12-C01-15 [LPRO] |
| Start position on genome | 31438 |
| End posion on genome | 31351 |
| Amino Acid | Ser |
| Anticodon | GCT |
| Upstream region at tRNA start position |
agtacttatt |
| tRNA gene sequence |
GCCGGGGTCGCCTAGCTCGGTAGGGCGGAGGCCTGCTAAGCCTCTGGGGTCCCACCCCGC |
| Downstream region at tRNA end position |
tgaatattat |
| Secondary structure (Cloverleaf model) | >W1610840348 Ser GCT
t GCCA tgaatattat
G - C
C - G
C - G
G - C
G - C
G - C
G - C T A
T C G C C C A
C G A C | | | | | A
T T C C G G C G G G C
C + | | | T T
G G G G C
G T A G TGGGGTCCCACCCCGC
G - C
A - T
G - C
G - C
C - G
C A
T A
G C T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |