Sequence ID | >W1610840371 |
Genome ID | LPRP01000003 |
Search identical group | |
Phylum/Class | Thermoproteota |
Species | Sulfolobus acidocaldarius GG12-C01-16 [LPRP] |
Start position on genome | 771569 |
End posion on genome | 771493 |
Amino Acid | Val |
Anticodon | CAC |
Upstream region at tRNA start position |
tctaattatT |
tRNA gene sequence |
GGGCCCGTAGTCTAGCCTGGTTAGGACGCTGCCCTCACACGGCAGAAGTCCCGAGTTCAA |
Downstream region at tRNA end position |
gggggacacc |
Secondary structure (Cloverleaf model) | >W1610840371 Val CAC T ATgt gggggacacc G - C G - C G - C C - G C - G C - G G - C T A T G G C T C A C C G A A | | | | | A T T C T G C C G A G C G + | | | T T G G G A C T T A G AAGTC C - G T - A G - C C - G C - G C C T A C A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |