Sequence ID | >W1610840465 |
Genome ID | LPRT01000002 |
Search identical group | |
Phylum/Class | Thermoproteota |
Species | Sulfolobus acidocaldarius GG12-C01-21 [LPRT] |
Start position on genome | 711524 |
End posion on genome | 711599 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
gaatttagat |
tRNA gene sequence |
GGACCCGTAGCTTAGCCAGGACAGAGTGCCAGTCTCCGGAACTGGTGGTCCCGGGTTCAA |
Downstream region at tRNA end position |
tgggggatac |
Secondary structure (Cloverleaf model) | >W1610840465 Arg CCG t GCtg tgggggatac G - C G - C A - T C - G C - G C - G G - C T A T G G C C C A C C G A A | | | | | A A T T C G C C G G G C G + | | + T T G G A G T A C A G TGGTC C - G C - G A - T G - C T - A C A T G C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |