Sequence ID | >W1610840478 |
Genome ID | LPRT01000005 |
Search identical group | |
Phylum/Class | Thermoproteota |
Species | Sulfolobus acidocaldarius GG12-C01-21 [LPRT] |
Start position on genome | 153325 |
End posion on genome | 153251 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
acataacaat |
tRNA gene sequence |
GGGCCGGTAGCTCAGCCTGGAAGAGTGCTTGGCTTGCAACCGAGAGGTCCCGGGTTCAAA |
Downstream region at tRNA end position |
tgggggtgtc |
Secondary structure (Cloverleaf model) | >W1610840478 Ala TGC t ACtg tgggggtgtc G - C G - C G + T C - G C - G G - C G - C T A T G G C C C A C G A A | | | | | A C C T C G C C G G G C T | | | + T T G G A G T G A A G AGGTC C - G T - A T + G G - C G - C C A T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |