| Sequence ID | >W1610840484 |
| Genome ID | LPRT01000008 |
| Phylum/Class | Thermoproteota |
| Species | Sulfolobus acidocaldarius GG12-C01-21 [LPRT] |
| Start position on genome | 46249 |
| End posion on genome | 46325 |
| Amino Acid | Arg |
| Anticodon | GCG |
| Upstream region at tRNA start position |
gttagttcaT |
| tRNA gene sequence |
GGACCCGTAGCTTAGCCAGGACAGAGTGCTGGCCTGCGGAGCCAGTGGTCCCGGGTTCAA |
| Downstream region at tRNA end position |
atctttatca |
| Secondary structure (Cloverleaf model) | >W1610840484 Arg GCG
T GAta atctttatca
G - C
G - C
A - T
C - G
C - G
C - G
G - C T A
T G G C C C A
C C G A A | | | | | A
A T T C G C C G G G C
G + | | + T T
G G A G T
A C A G TGGTC
C - G
T - A
G - C
G - C
C - G
C A
T G
G C G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |