| Sequence ID | >W1610840496 |
| Genome ID | LPRU01000002 |
| Phylum/Class | Thermoproteota |
| Species | Sulfolobus acidocaldarius GG12-C01-22 [LPRU] |
| Start position on genome | 13790 |
| End posion on genome | 13716 |
| Amino Acid | Val |
| Anticodon | GAC |
| Upstream region at tRNA start position |
ctattagaga |
| tRNA gene sequence |
GGGCCCGTCGTCTAGCCTGGTTAGGACGCTGCCCTGACGCGGCAGAAATCCTGGGTTCAA |
| Downstream region at tRNA end position |
gggggataac |
| Secondary structure (Cloverleaf model) | >W1610840496 Val GAC
a Attt gggggataac
G - C
G - C
G - C
C - G
C - G
C - G
G - C T G
T G A C C C A
C C G A C | | | | | A
T T C T G C T G G G C
G + | | | T T
G G G A C
T T A G AAATC
C - G
T - A
G - C
C - G
C - G
C C
T G
G A C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |