| Sequence ID | >W1610840517 |
| Genome ID | LPRV01000005 |
| Phylum/Class | Thermoproteota |
| Species | Sulfolobus acidocaldarius NG05A_C04 [LPRV] |
| Start position on genome | 238411 |
| End posion on genome | 238485 |
| Amino Acid | Ala |
| Anticodon | GGC |
| Upstream region at tRNA start position |
agtatattgt |
| tRNA gene sequence |
GGGCCGGTAGCTCAGCCTGGAAGAGTGCGTGGTTGGCATCCACGAGGTCCCGGGTTCAAA |
| Downstream region at tRNA end position |
ttttgtacta |
| Secondary structure (Cloverleaf model) | >W1610840517 Ala GGC
t ACtc ttttgtacta
G - C
G - C
G + T
C - G
C - G
G - C
G - C T A
T G G C C C A
C G A A | | | | | A
C C T C G C C G G G C
T | | | + T T
G G A G T
G A A G AGGTC
C - G
G - C
T - A
G - C
G - C
T T
T A
G G C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |