Sequence ID | >W1610840549 |
Genome ID | LPRW01000005 |
Search identical group | |
Phylum/Class | Thermoproteota |
Species | Sulfolobus acidocaldarius NG05A_C05_01 [LPRW] |
Start position on genome | 92672 |
End posion on genome | 92586 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
tcttattaaT |
tRNA gene sequence |
GCCGGGGTGCCCGAGTGGACTAAGGGGCTGGCCTGGAGAGCCAGTGTGGATCTTCCACGC |
Downstream region at tRNA end position |
tgggggattc |
Secondary structure (Cloverleaf model) | >W1610840549 Ser GGA T GTag tgggggattc G - C C - G C - G G - C G - C G - C G - C T A T C G C C C A T G A G | | | | | A G G C C C G C G G G C G | | | T T A A G G G C T A G TGTGGATCTTCCACGC C - G T - A G - C G - C C - G C A T G G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |