| Sequence ID | >W1610840977 |
| Genome ID | LPSN01000002 |
| Phylum/Class | Thermoproteota |
| Species | Sulfolobus acidocaldarius NG05B_CO5_08 [LPSN] |
| Start position on genome | 435395 |
| End posion on genome | 435321 |
| Amino Acid | Val |
| Anticodon | TAC |
| Upstream region at tRNA start position |
aatagcttga |
| tRNA gene sequence |
GGGCCCGTCGTCTAGCCTGGTTAGGACGTCGCCCTTACAAGGCGGAGGTCCTGGGTTCAA |
| Downstream region at tRNA end position |
ttttacatta |
| Secondary structure (Cloverleaf model) | >W1610840977 Val TAC
a Atac ttttacatta
G - C
G - C
G - C
C - G
C - G
C - G
G - C T A
T G A C C C A
C C G A C | | | | | A
T T C T G C T G G G C
G + | | | T T
G G G A C
T T A G AGGTC
T + G
C - G
G - C
C - G
C - G
C A
T A
T A C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |