| Sequence ID | >W1610841157 |
| Genome ID | LPSU01000004 |
| Phylum/Class | Thermoproteota |
| Species | Sulfolobus acidocaldarius NG05B_CO5_15 [LPSU] |
| Start position on genome | 1247832 |
| End posion on genome | 1247906 |
| Amino Acid | Asp |
| Anticodon | GTC |
| Upstream region at tRNA start position |
attgccgcgT |
| tRNA gene sequence |
GCCGCGGTAGTCTAGCGGTCTAGGATGGGGGCCTGTCGAGCCCTTGACCCGGGTTCAAAT |
| Downstream region at tRNA end position |
tactacatat |
| Secondary structure (Cloverleaf model) | >W1610841157 Asp GTC
T GTtg tactacatat
G - C
C - G
C - G
G - C
C - G
G - C
G - C T A
T G G C C C A
C G A A | | | | | A
G T C T G C C G G G C
G + | | + T T
T G G A T
C T A G TGAC
G + T
G - C
G - C
G - C
C - G
C A
T G
G T C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |