Sequence ID | >W1610847161 |
Genome ID | LPYI01000055 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Escherichia coli [LPYI] |
Start position on genome | 74919 |
End posion on genome | 74844 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
aggaaccaac |
tRNA gene sequence |
GCCGACTTAGCTCAGCAGGCAAAGCAACTGACTTGTAATCAGTAGGTCACCAGTTCGATT |
Downstream region at tRNA end position |
tatgcgggta |
Secondary structure (Cloverleaf model) | >W1610847161 Thr TGT c ACCA tatgcgggta G - C C - G C - G G - C A - T C - G T - A T T T T G G C C A C G A A | | | | G A C T C G A C C A G C G | | | T T G A A G C C A A AGGTC A - T C - G T - A G - C A - T C A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |