Sequence ID | >W1610851115 |
Genome ID | LQBL01000007 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Serinicoccus chungangensis [LQBL] |
Start position on genome | 9363 |
End posion on genome | 9287 |
Amino Acid | Val |
Anticodon | CAC |
Upstream region at tRNA start position |
gggcacgtcc |
tRNA gene sequence |
GGACGTGTAGCTCAGTTGGTTAGAGCGTTCGCTTCACACGCGAGAGGTCAGGGGTTCGAG |
Downstream region at tRNA end position |
tgctattcca |
Secondary structure (Cloverleaf model) | >W1610851115 Val CAC c ACCC tgctattcca G - C G - C A - T C - G G - C T - A G - C T G T T T C C C A T G A A | + | | | G T C T C G A G G G G C G | | | | T T G G A G C T T A G AGGTC T + G T - A C - G G - C C - G T C T A C A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |