Sequence ID | >W1610855314 |
Genome ID | LQMQ01000005 |
Search identical group | |
Phylum/Class | Unclassified |
Species | Candidatus Hadarchaeum yellowstonense YNP_45 [LQMQ] |
Start position on genome | 12680 |
End posion on genome | 12756 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
tattttgcgt |
tRNA gene sequence |
GCCGGGGTTGCTAAGCTCGGTAAAGCGGTGGGCTGCAGACCCGCTATTCGTCGGTTCAAA |
Downstream region at tRNA end position |
cgtctttttt |
Secondary structure (Cloverleaf model) | >W1610855314 Cys GCA t TCCA cgtctttttt G - C C - G C - G G - C G - C G - C G - C T A T C A G C C A C G A T | | | | | A T A T C G G T C G G C C | | | T T G A A G C G T A G TATTC G - C T + G G - C G - C G - C C A T G G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |