Sequence ID | >W1610893149 |
Genome ID | LRSL01000069 |
Search identical group | |
Phylum/Class | Unclassified |
Species | Candidatus Thorarchaeota archaeon SMTZ1-45 [LRSL] |
Start position on genome | 157554 |
End posion on genome | 157630 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
tcgacctaca |
tRNA gene sequence |
CGGGACGTAGCTCAATTTGGCAGAGCAATGGACTGTAGATCCATCGGTTGCCGGTTCAAA |
Downstream region at tRNA end position |
tcccttttct |
Secondary structure (Cloverleaf model) | >W1610893149 Tyr GTA a ACCA tcccttttct C - G G - C G - C G - C A - T C - G G - C T A T C G G C C A T A A A | | | | | A T C T C G G C C G G C T | | | | T T G G A G C G C A A CGGTT A - T T - A G - C G - C A - T C A T G G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |