| Sequence ID | >W1610893150 |
| Genome ID | LRSL01000069 |
| Phylum/Class | Unclassified |
| Species | Candidatus Thorarchaeota archaeon SMTZ1-45 [LRSL] |
| Start position on genome | 142447 |
| End posion on genome | 142372 |
| Amino Acid | Thr |
| Anticodon | TGT |
| Upstream region at tRNA start position |
tgcaggttgt |
| tRNA gene sequence |
GCCCCAGTGGCTTAGAGGCTATAGCGGCTGACTTGTAATCAGCAGGTCGCGAGTTCAAAT |
| Downstream region at tRNA end position |
tctatacgta |
| Secondary structure (Cloverleaf model) | >W1610893150 Thr TGT
t TCCA tctatacgta
G - C
C - G
C - G
C - G
C - G
A - T
G - C T A
T C G C T C A
A G A G | | | | | A
G T T C G G C G A G C
G | | | T T
C T A G C
T A G AGGTC
G - C
C - G
T - A
G - C
A - T
C A
T A
T G T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |