Sequence ID | >W1610909663 |
Genome ID | LSFI01000028 |
Search identical group | |
Phylum/Class | Thermodesulfobacteriota |
Species | Thermodesulfatator autotrophicus [LSFI] |
Start position on genome | 189 |
End posion on genome | 264 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
cgcaaacgga |
tRNA gene sequence |
GCGGGTATAGCTCAGTTGGTAGAGCATCAGCTTCCCAAGCTGAGGGTCGCGGGTTCGAAT |
Downstream region at tRNA end position |
gaagttaacc |
Secondary structure (Cloverleaf model) | >W1610909663 Gly CCC a TCCA gaagttaacc G - C C - G G - C G - C G - C T + G A - T T A T T G C C C A T G A A + | | | | G T C T C G G C G G G C G | | | | T T G G A G C T A A GGGTC T - A C - G A - T G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |