Sequence ID | >W1610914136 |
Genome ID | LSJW01000292 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Microbacterium sp. CCH5-D1 [LSJW] |
Start position on genome | 23435 |
End posion on genome | 23351 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
atcccaccgc |
tRNA gene sequence |
GCGGGAGTGGTGGAATTGGCAGACACGCAGGATTTAGGTTCCTGTGCCCCAGGGCGTGTG |
Downstream region at tRNA end position |
gagacgacgg |
Secondary structure (Cloverleaf model) | >W1610914136 Leu TAG c ACGA gagacgacgg G - C C - G G - C G - C G + T A - T G - C T G T C A C C C A T A A G | | | | | A T G G T G G T G G G C G | | | T T G A C A C C A G G TGCCCCAGGGCGT C - G A - T G - C G - C A - T T T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |