Sequence ID | >W1610914197 |
Genome ID | LSJY01000070 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Sphingobium sp. CCH11-B1 [LSJY] |
Start position on genome | 38658 |
End posion on genome | 38569 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
gtcggtcaaa |
tRNA gene sequence |
GGACAGGTGGCCGAGTGGTTTAAGGCAGCGGTCTTGAAAACCGCCGTGGGTTTACGCTCA |
Downstream region at tRNA end position |
cttgccgctg |
Secondary structure (Cloverleaf model) | >W1610914197 Ser TGA a GCCA cttgccgctg G - C G - C A - T C - G A - T G - C G - C T A T C A C C C A T G A G | | | | | G G G C C G G T G G G C G | | | T T T A G G C T T A A CGTGGGTTTACGCTCACC G - C C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |