Sequence ID | >W1610914535 |
Genome ID | LSKF01000119 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Erythrobacteraceae bacterium CCH12-C2 [LSKF] |
Start position on genome | 15167 |
End posion on genome | 15241 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
gcgccagtga |
tRNA gene sequence |
GCGGGCGTAGCTCAGGGGTAGAGCACAACCTTGCCAAGGTTGGGGTCGAGGGTTCGAATC |
Downstream region at tRNA end position |
tatttttatc |
Secondary structure (Cloverleaf model) | >W1610914535 Gly GCC a TCCA tatttttatc G - C C - G G - C G - C G - C C - G G - C T A T T T C C C A G A A + | | | | G G C T C G G A G G G C G | | | | T T G G A G C T A A GGGTC C - G A - T A - T C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |