Sequence ID | >W1610914638 |
Genome ID | LSKI01000019 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Sphingomonas sp. CCH18-H6 [LSKI] |
Start position on genome | 13300 |
End posion on genome | 13385 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
gcggcccaat |
tRNA gene sequence |
GGACAGGTGGCCGAGTGGTTAAAGGCAGCAGACTGTAAATCTGCCCGCGTGAGCGTACGC |
Downstream region at tRNA end position |
ccaacctttc |
Secondary structure (Cloverleaf model) | >W1610914638 Tyr GTA t ACCA ccaacctttc G - C G - C A - T C - G A - T G - C G - C T A T C G A C C A T G A G | | | | | G G G C C G G C T G G C G | | | T T T A G G C T A A A CCGCGTGAGCGTAC G - C C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |