Sequence ID | >W1610919943 |
Genome ID | LSSB01000089 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Theionarchaea archaeon DG-70 DG-70 [LSSB] |
Start position on genome | 47 |
End posion on genome | 131 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
atagtaaaaa |
tRNA gene sequence |
GCGGGGGTTGCCGAGCTTGGAAAAGGCGCAGGGTTTAGGACCCTGTTCCGTAGGGATCCG |
Downstream region at tRNA end position |
tttatgggtc |
Secondary structure (Cloverleaf model) | >W1610919943 Leu TAG a ACtt tttatgggtc G - C C - G G - C G - C G - C G - C G - C T A T T A C C C A T C G A T + | | | | A T G C C G G T G G G C G | | | T T G A G G C A A A G TTCCGTAGGGATCC C - G A - T G - C G - C G - C T A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |