Sequence ID | >W1610919948 |
Genome ID | LSSB01000111 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Theionarchaea archaeon DG-70 DG-70 [LSSB] |
Start position on genome | 13493 |
End posion on genome | 13419 |
Amino Acid | Ala |
Anticodon | CGC |
Upstream region at tRNA start position |
gcaggcataa |
tRNA gene sequence |
GGGCTCGTAGCTCAGCTGGTATGAGCGCTGCCTTCGCAAGGCAGAGGCCGCGGGTTCAAA |
Downstream region at tRNA end position |
gcaaataaga |
Secondary structure (Cloverleaf model) | >W1610919948 Ala CGC a ACtc gcaaataaga G - C G - C G + T C - G T - A C - G G - C T A T C G C C C A C G A A | | | | | A T C T C G G C G G G C G | | | | T T G G A G C T A T G AGGCC C - G T - A G - C C - G C - G T A T A C G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |