Sequence ID | >W1610919976 |
Genome ID | LSSC01000101 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Theionarchaea archaeon DG-70-1 DG-70-1 [LSSC] |
Start position on genome | 4981 |
End posion on genome | 5053 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
tacaatctca |
tRNA gene sequence |
GCCGCCGTAGCTCAATTGGAAGAGCGCCCGCCTGTTAAGCGGATGGTTCCAGGTTCGAGT |
Downstream region at tRNA end position |
agcagcttgt |
Secondary structure (Cloverleaf model) | >W1610919976 Asn GTT a Gtgc agcagcttgt G - C C - G C - G G - C C - G C - G G - C T G T G G T C C A T A A A | | | | | G T C T C G C C A G G C G | | | | T T G G A G C A A G TGGTT C A C - G C - G G - C C - G C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |