Sequence ID | >W1610921186 |
Genome ID | LSTV01000001 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Microbacterium oleivorans [LSTV] |
Start position on genome | 1115745 |
End posion on genome | 1115670 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
gggtgactga |
tRNA gene sequence |
TCCTCGGTAGCTCAATTGGCAGAGCAATCGGCTGTTAACCGATAGGTTCTTGGTTCGAGT |
Downstream region at tRNA end position |
ttgaacgaaa |
Secondary structure (Cloverleaf model) | >W1610921186 Asn GTT a GCCA ttgaacgaaa T - A C - G C - G T + G C - G G - C G - C T G T G A A C C A T A A A | | | | | G T C T C G C T T G G C G | | | | T T G G A G C C A A AGGTT A - T T - A C - G G - C G - C C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |