Sequence ID | >W1610921350 |
Genome ID | LSUI01000040 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Bifidobacterium bifidum [LSUI] |
Start position on genome | 9079 |
End posion on genome | 9005 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
tgccagaaac |
tRNA gene sequence |
GCCCTCGTATCCCAATTGGTAGAGGAAGCAGCCTCAAAATCTGCGCAGTGTGGGTTCGAG |
Downstream region at tRNA end position |
tgcattatcg |
Secondary structure (Cloverleaf model) | >W1610921350 Leu CAA c ACgt tgcattatcg G - C C - G C - G C - G T - A C - G G - C T G T C A C C C A T A A A | | | | | G T C C C T G T G G G C G | | | T T G A G G A T A G A GCAGT G - C C - G A - T G - C C T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |