Sequence ID | >W1610922620 |
Genome ID | LSVG01000042 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Sphingobium yanoikuyae [LSVG] |
Start position on genome | 3084 |
End posion on genome | 2999 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
aaggcgcagc |
tRNA gene sequence |
GCGGACGTGGCGAAATCGGTAGACGCAGCGGACTTAAAATCCGCCTCCCCCTGGGAATAT |
Downstream region at tRNA end position |
ggaaaatcaa |
Secondary structure (Cloverleaf model) | >W1610922620 Leu TAA c ACCA ggaaaatcaa G - C C - G G - C G - C A - T C - G G - C T G T T A C C C A T A A G | | | | | A C A G C G A T G G G C G | | | T T G A C G C T A G A CTCCCCCTGGGAAT G - C C - G G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |