Sequence ID | >W1610925930 |
Genome ID | LTDG01000065 |
Search identical group | |
Phylum/Class | Verrucomicrobiota |
Species | Akkermansia sp. KLE1797 [LTDG] |
Start position on genome | 109623 |
End posion on genome | 109549 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
gtcatccaaa |
tRNA gene sequence |
GCGGATGTAGCTCAGGGGTAGAGCGCAACCTTGCCAAGGTTGATGTCGTGGGTTCGAATC |
Downstream region at tRNA end position |
ttttttcttt |
Secondary structure (Cloverleaf model) | >W1610925930 Gly GCC a TCCA ttttttcttt G - C C - G G - C G - C A - T T - A G - C T A T T A C C C A G A A + | | | | G G C T C G G T G G G C G | | | | T T G G A G C T A G ATGTC C - G A - T A - T C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |