Sequence ID | >W1610927897 |
Genome ID | LUCF01000019 |
Search identical group | |
Phylum/Class | Unclassified |
Species | Candidatus Bathyarchaeota archaeon B63 [LUCF] |
Start position on genome | 15959 |
End posion on genome | 16044 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
cgaacaataa |
tRNA gene sequence |
GCGGGGGTGTCCGAGTGGTCAAAGGAGGCAGGCTTAGGACCTGCTGGCGTAGGCCTGCGC |
Downstream region at tRNA end position |
acctagtgct |
Secondary structure (Cloverleaf model) | >W1610927897 Leu TAG a ACCA acctagtgct G - C C - G G - C G - C G - C G - C G - C C A T C G C C C A T G A G | | | | | G G G C C T G C G G G C G | | | T T T A G G A C A A G TGGCGTAGGCCTGC G - C C - G A - T G - C G - C C A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |