Sequence ID | >W1610927993 |
Genome ID | LUCJ01000034 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Novacetimonas hansenii [LUCJ] |
Start position on genome | 71227 |
End posion on genome | 71152 |
Amino Acid | Glu |
Anticodon | CTC |
Upstream region at tRNA start position |
cttcggcctt |
tRNA gene sequence |
GTCCCGTTCGTCTAGAGGCCTAGGACACCGCCCTCTCACGGCGGCAACACGGGTTCGAAT |
Downstream region at tRNA end position |
ctgtttctgc |
Secondary structure (Cloverleaf model) | >W1610927993 Glu CTC t GCCA ctgtttctgc G - C T - A C - G C - G C - G G - C T - A T A T T G C C C A A G A C | | | | | G G T C T G A C G G G C G + | | | T T C G G A C C T A A CAAC C - G C - G G - C C - G C - G C C T A C T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |