Sequence ID | >W1610929079 |
Genome ID | LUDK01000002 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Riemerella anatipestifer [LUDK] |
Start position on genome | 38354 |
End posion on genome | 38282 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
ttttttataa |
tRNA gene sequence |
GCCGATATAGCTCAGCGGTAGAGCGCTTCCTTGGTAAGGAAGAGGTCTCGGGTTCAAGTC |
Downstream region at tRNA end position |
aatctctcag |
Secondary structure (Cloverleaf model) | >W1610929079 Thr GGT a TCtg aatctctcag G - C C - G C - G G + T A - T T - A A - T T G T A G C C C A G A A | | | | | A C C T C G T C G G G C G | | | | T T G G A G C T A G AGGTC C - G T - A T - A C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |