Sequence ID | >W1610935252 |
Genome ID | LUJV01000105 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Bacteroidales bacterium M11 [LUJV] |
Start position on genome | 80316 |
End posion on genome | 80240 |
Amino Acid | Ala |
Anticodon | GGC |
Upstream region at tRNA start position |
nnnnnnnnnn |
tRNA gene sequence |
GGGGTATTAGCTCATCTGGCTAGAGCGCGACACTGGCAGTGTCGAGGTGAGCGGTTCGAG |
Downstream region at tRNA end position |
acagcagatt |
Secondary structure (Cloverleaf model) | >W1610935252 Ala GGC n ACCA acagcagatt G - C G - C G + T G - C T - A A - T T - A T G T T C G C C A C T A A | | | | | G T C T C G A G C G G C G | | | | T T G G A G C C T A G AGGTG C - G G - C A - T C - G A - T C G T A G G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |