Sequence ID | >W1610937640 |
Genome ID | LUOY01000011 |
Search identical group | |
Phylum/Class | Nitrososphaerota |
Species | Nitrosopelagicus sp. REDSEA-S19_B12N3 [LUOY] |
Start position on genome | 6463 |
End posion on genome | 6539 |
Amino Acid | Lys |
Anticodon | CTT |
Upstream region at tRNA start position |
ttctttgtgt |
tRNA gene sequence |
GGGTCTATAGCGCAGCCAGGTAGCGCACCGGACTCTTAATCCGGCTGTCGTGGGTTCGAA |
Downstream region at tRNA end position |
ctgtaacttt |
Secondary structure (Cloverleaf model) | >W1610937640 Lys CTT t GCTA ctgtaacttt G - C G - C G - C T - A C - G T - A A - T T A T C A C C C A C G A A | | | | | G C C G C G G T G G G C A | | | | T T G G C G C G T A A CTGTC C - G C - G G - C G - C A - T C A T A C T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |