Sequence ID | >W1610938381 |
Genome ID | LUPY01000144 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Rhodobacteraceae bacterium REDSEA-S03_B4 [LUPY] |
Start position on genome | 2964 |
End posion on genome | 3047 |
Amino Acid | Pseudo |
Anticodon | GTA |
Upstream region at tRNA start position |
aatcaaaagt |
tRNA gene sequence |
GGGCGACAGGCCGCAAGGTGTGGCAGGGGACTGTAACTCCCTCGCGGAGACGCACGCTAG |
Downstream region at tRNA end position |
ctttaaaaat |
Secondary structure (Cloverleaf model) | >W1610938381 Pseudo GTA t ACCA ctttaaaaat G - C G - C G - C C - G G - C A - T C - G T T A G A T C C A A C G | | | | | G A G C C G C T A G G C G + | | | T T G T G G C T G A CGCGGAGACGCACG G + T G - C G - C G - C A - T C C T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |