Sequence ID | >W1610939214 |
Genome ID | LURJ01000021 |
Search identical group | |
Phylum/Class | Cyanobacteriota |
Species | Synechococcus sp. REDSEA-S01_B1 [LURJ] |
Start position on genome | 21905 |
End posion on genome | 21977 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
gatcgatgtc |
tRNA gene sequence |
GGGCGATTAGCTCAGGGGTAGAGCACTACATTGACATTGTAGGAGTCACTGGTTCAAATC |
Downstream region at tRNA end position |
tccctgtagg |
Secondary structure (Cloverleaf model) | >W1610939214 Val GAC c ACtt tccctgtagg G - C G - C G - C C - G G - C A - T T - A T A T T G A C C A G A A | | | | | A G C T C G A C T G G C G | | | | T T G G A G C T A A GAGTC C - G T - A A - T C - G A - T T T T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |