Sequence ID | >W1610939318 |
Genome ID | LURN01000030 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Candidatus Thioglobus sp. REDSEA-S12_B1 [LURN] |
Start position on genome | 32526 |
End posion on genome | 32451 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
tttgatatat |
tRNA gene sequence |
AGGCAAGTGGCTCAATTGGTAGAGTAGTGGTCTCCAAAACCATTGGTTGGGGGTTCGAGT |
Downstream region at tRNA end position |
aattaaagga |
Secondary structure (Cloverleaf model) | >W1610939318 Trp CCA t GCCA aattaaagga A - T G - C G - C C - G A - T A - T G - C T G T C T C C C A T A A G | + | | | G T C T C G G G G G G C G | | | + T T G G A G T T A A TGGTT G + T T - A G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |